HUELLAS GÉNICAS

53

La historia comienza así: Distrito de Quenns, Nueva York, 17:15 horas. La policía descubre el cuerpo sin vida de una mujer blanca de 49 años de edad en un vetusto departamento de la barriada de Flushing; tras una primera valoración, todo parecía indicar que fue atacada en la cocina, arrastrada hasta el dormitorio, atada y despojada de sus ropas, violada y para completar la horripilante acción el ignoto la apuñalo 31 veces; el cuerpo maltratado de la mujer que yace bocarriba en la cama empieza a mostrar los primeros signos de descomposición.

Armados con el laser forense Omniprint 1000, los detectives de la Sección de Homicidios iluminan las sábanas ensangrentadas para revelar las posibles manchas de semen que pasarían inadvertidas en un rastreo rutinario (este procedimiento lo hemos visto “n” cantidad de veces cuando vemos algún capítulo de CSI, Las Vegas, NY o Miami).

En el Instituto Anatómico Forense alrededor de las 20:00 horas, en una de las salas adyacentes al depósito de cadáveres, el médico forense introduce en la vagina de la mujer un hisopo de algodón, tras la exploración consigue extraer un fluido que podría ser de semen y que de pertenecer al violador servirá –de no surgir inconvenientes– para darle caza e incriminarlo, inmediatamente la prueba es enviada al laboratorio de bioquímica, junto con el trozo de la sábana manchada, para saber si realmente contiene espermatozoides, mediante marcadores inmunológicos y una observación al microscopio electrónico de barrido, los analistas confirman la sospecha, hay esperma. La caza del asesino ha empezado.

(En México, podría considerarse que tenemos estos adelantos, pero, debido a una orden oficial, a un mandato de “más arriba”, las probables pruebas positivas para considerar a alguien comprometido en un delito, “desaparecen misteriosamente”, son “negativas”, no “se obtuvieron las suficientes”, o, están “degradadas”.)

descargaCiudad de Washington, Laboratorio Serológico del US Federal Bureau of Investigation (FBI), dos días más tarde un biólogo vierte el contenido de la probeta en un vaso de vidrio, se trata del líquido seminal extraído de la vagina de la mujer asesinada tras aislar los espermatozoides del epitelio vaginal los especialistas se disponen a recabar la molécula del ácido desoxirribonucleico (ADN) de las células espermáticas y llegar a la identificación personal del individuo; la posibilidad de que dos personas tengan la misma huella génica es remota, una entre un billón (mil millones) según los expertos. La huella génica es, por tanto, tan exclusiva como la dactilar.

Con enzimas de restricción – unas auténticas tijeras moleculares – el biólogo rompe la hebra de ADN por sitios específicos en miles de fragmentos de distinta longitud, estos son separados y ordenados por tamaños mediante una técnica conocida como electroforesis en gel de agarosa, lo que se logra apreciar en el gel es una banda continua con infinidad de pedazos de ADN agolpados; el paso siguiente es desenmascarar los segmentos de material genético que nos interesan, para ello la policía científica del FBI utiliza sondas radioactivas, pequeñas secuencias de ADN sintetizadas por ingeniería genética que buscan y se anclan en determinados segmentos, al estar marcadas con sustancias radioactivas, como fósforo-32 y fosfatasa alcalina, basta acercar una placa fotográfica para que queden marcadas en ella, el resultado final es una especie de código de barras similar al que identifican a los productos de los supermercados.

De esta forma el FBI construye el “perfil molecular” del delincuente repitiendo el proceso con la sangre de los sospechosos que sean detenidos, la policía podrá saber cuál de ellos es el autor del asesinato.

Sin duda alguna, la huella génica se ha convertido en una herramienta imprescindible para la policía y los jueces. Desde 1987, sólo en EU donde se producen 80 mil violaciones y 20 mil homicidios al año, la prueba del ADN se ha recabado en más de un millón de investigaciones criminales. Sin embargo, pocos casos han llegado a juicio ya que, en la mayoría de las ocasiones, los acusados se confesaron culpables después de que la prueba de la huella génica fuera positiva y al declararse culpables ya no hay que colocar las pruebas del ADN en la mesa del jurado.

Las huellas génicas están sirviendo para librar inocentes de una condena segura.

La criminalística biológica es el análisis de los vestigios exclusivamente biológicos, manchas de esperma, sangre, pelos, saliva dejados por el sujeto que ha cometido un delito.

¿Pero que son las huellas génicas?

Estos diminutos detectives moleculares fueron descubiertos en 1985 por Alec J. Jeffreys, del Departamento de Genética de la Universidad de Leicester, en Gran Bretaña. En ese mismo año, el Ministerio del Interior británico solicitó la ayuda de Jeffreys para resolver un conflicto en el caso de inmigrantes.

El Ministro del Interior es área del Poder Ejecutivo encargada de las normas y acciones sobre políticas internas orientadas a mantener el orden público, la seguridad y la paz social, es también el encargado de gestionar las relaciones del jefe de gobierno con las organizaciones políticas de un país; también se le denomina Secretaría (o Ministro) de Asuntos Internos, Secretaría del Interior, Secretaría de Gobernación o de Gobierno.

Es el ministro político por excelencia y la denominación “del interior” sería el antónimo del Ministro de Relaciones Exteriores, para significar que sus funciones consisten en gestionar las relaciones con las fuerzas políticas y sociales internas. Es también el encargado del orden interior del Estado, lo que significa que suele estar al mando de las fuerzas policiales y de inteligencia nacionales. Conocido como el MI5.

Hoy la huella génica no solo se aplica a criminales y violadores, sino que está siendo de gran utilidad para la identificación de cadáveres carbonizados, cuyo reconocimiento mediante técnicas forenses clásicas plantea serios problemas, y la búsqueda de personas desaparecidas en catástrofes, guerras y accidentes.

¿A qué temperatura se quema un cuerpo para quedar reducido a cenizas?

Al estar compuesto en gran parte por agua, el cuerpo humano no arde muy bien. Sin embargo, en muchos casos, los cuerpos de las víctimas son reducidos a cenizas. Para llegar el cuerpo a tal estado se necesitan temperaturas de más de 1.700°C. Incluso en los modernos crematorios, que alcanzan temperaturas cercanas a los 1.100°C, los huesos no se consumen completamente y tienen que ser molidos.

La velocidad de propagación de esta combustión es muy alta y esto no es muy común, es necesario para entender esto que los crematorios el proceso de incineración de cadáveres duran horas y aun así los huesos tendrán que ser machacados para reducirlos.

¿El Campo Militar No 1 de la ciudad de México, tiene un crematorio?

El miércoles 7 de enero del 2015: el director general de Comunicación Social de la Secretaría de la Defensa Nacional, el General Brigadier Martín Terrones Calvario, emitió una aclaración en la prensa sobre “la hipótesis científica que se centra en los crematorios del Ejército y en privados”. “Al respecto, les hago saber que ninguna instalación militar del país cuenta con crematorios”, dice la aclaración dada a conocer.

A su vez el Instituto de Seguridad Social para las Fuerzas Armadas (ISSFAM) en sus memorias anuales y, respecto a los servicios funerarios que ofrece, se establece en el documento público correspondiente a 2013:

“El Velatorio Militar ubicado en Puebla, Puebla, en el Campo Militar 25-A cuenta con servicios funerarios en sus tres salas de velación, además de ofrecer servicio de carrozas, transporte de dolientes, gestoría y horno crematorio”.

Según el manual, “el horno crematorio prestará servicio de las 08:00 horas a las 18:00 horas con ampliación de horario en casos especiales o extraordinarios”.

Un mayor del ejército (se omite nombre) ofrece detalles de la cremación vía telefónica: “La incineración se realiza por completo en tres horas con un equipo de gas cien por ciento ecológico”,

“El personal, tanto del Cementerio como del Velatorio, está adscrito
a las fuerzas armadas: ejército, armada o fuerza área. Ambas instalaciones pertenecen al ISSFAM, organismo cuya junta directiva se integra por nueve miembros: tres designados por la Secretaría de la Defensa Nacional, tres por la de Marina y tres por la de Hacienda y Crédito Público. Su Director General es el general de división Diplomado del Estado Mayor Jesús Javier Castillo Cabrera”.

 Se sabe, eso sí, de que existen hornos crematorios en la ciudad  de México, del estado de Guerrero, en Chilpancingo, a pocos kilómetros de la ciudad de Iguala, Guerrero, en Puebla y otros estados.

“[…] A los 15 minutos llegaban camiones del ejercito que cargaban los cadáveres; ambulancias que recogían a los heridos y una hora más tarde los camiones de limpieza de la ciudad, limpiando cualquier rastro de lo ocurrido.
Esa noche el cielo de la ciudad de México empezó a recibir bocanadas de humo negro que salía de los hornos crematorios del Campo Militar No. 1.

Allí iban las cenizas de una parte de la flor de la juventud mexicana, cuya acción con todos los integrantes de aquel Movimiento Estudiantil Popular, fue inolvidable en la vida de todos los que lo vivimos..

Hoy en Asturias, a 47 años de aquel 2 de octubre de 1968, de la Matanza de Tlatelolco, vayan estas líneas en recuerdo de aquellos muchachos y muchachas que dieron su vida por cambiar el país […].

“Reflexiones de Belarmino”.

“Aquella noche, la bengala y los hornos crematorios” 2 octubre del 2015”. Asturias, España.

Así es que imaginen que hubo personas, mexicanos, gente del pueblo, que tuvieron que dejar reducidos a polvo a cientos de huesos humanos, a mexicanos como ellos, a jóvenes que estaban luchando por un ideal, bueno o malo, ya cada quien lo decidirá, pero que decidieron por ellos mismos no tener piedad de ninguna clase y reducirlos a cenizas, a polvo, a nada. Y hubo otros que los esparcieron, los tiraron, los vertieron en cloacas o los tiraron a la tierra árida. Comandados, dirigidos por otros mexicanos que dieron la orden de hacerlo, a su vez obedeciendo orden directa de un personaje mayor, oculto, escondido, parapetado en sus influencias, dinero y poder.

Los científicos también extraen el material hereditario conservado en los tejidos de las momias. El ADN de nuestros antepasados se compara con el de poblaciones actuales para de esta forma reconstruir la historia de la humanidad.

La fiabilidad de la huella génica se basa en que ningún hombre es idéntico a otro. Es más, incluso entre hermanos gemelos existen pequeñas diferencias a nivel molecular. Nuestro cuerpo está formado por aproximadamente 50 billones de células, cada una de las cuales, a excepción hecha por los glóbulos rojos – contiene un juego completo de cromosomas; 23 heredados de la madre y 23 del padre.

Resultado de imagen para ADN SALIVACada cromosoma es en esencia un paquete compactado de ADN, una molécula larga y delgada que contiene la información para el desarrollo de un individuo. Como demostraron Watson y Crick, esta molécula de la vida está formada por una doble hélice, es decir, dos largas hebras perfectamente enrolladas. Cada hilo se forma a partir de una secuencia de tres mil millones de bases nucleicas: adenina (A), guanina (G), citosina (C) y timina (T). Estas representan el diccionario molecular del complejo mensaje genético.

Aunque la mayor parte del ADN humano presenta mínimas variaciones de un individuo a otro. Jeffreys descubrió que existen unas regiones, bautizadas como el nombre de minisatélites y microsatélites, extremadamente variables repartidas a lo largo de los cromosomas. En la obtención de una huella, lo que realmente interesa son fragmentos de ADN polimórficos, es decir, que sean muy distintos de una persona a otra, ya que en la variedad está la clave del éxito de la técnica. Los minisatélites no son otra cosa que pequeñas secuencias de bases que se repiten una vez y otra. Así por ejemplo, si un encadenamiento normal de ADN se escribe AGGATGCTCAAT… un minisatélite podría ser algo como AGGACTCTCTCTCTTGCTCAAT… Este contiene múltiples copias del par CT que se repiten de forma muy aleatoria en la cadena ADN. Un minisatélite tiene entre diez y veinte pares de bases repetidas N veces, mientras que un microsatélite no sobrepasa los cinco pares de bases copiados múltiples veces. Como resultado, estas minisecuencias se pueden presentar con centenares de longitudes distintas, lo que permite diferenciar el material hereditario de distintas personas.

Los genetistas han conseguido identificar algunas de estas secuencias hipervariables dentro de la población, y sintetizar a partir de ellas sondas radiactivas capaces de identificar los minisatélites de la molécula de ADN con el que se esté llevando a cabo la huella génica. Los minisatélites aparecen en la cromatografía libres y ordenados por tamaños, como hemos mencionado anteriormente. Este tipo de huellas génicas se basa en sondas de locus múltiple, llamadas así porque detectan múltiples minisatélites en diferentes regiones de material hereditario. Lo que se obtiene es un complejo patrón de bandas en el que algunas de ellas pueden aparecer borrosas e incluso llegar a desaparecer. Esta pérdida de información puede enmascarar los resultados.

Sin embargo, utilizando técnicas de ingeniería molecular, los científicos han podido aislar del genoma humano minisatélites concretos, para fabricar a partir de ellos una batería de sondas revolucionarias. Se trata de las sondas de locus único, capaces de detectar una cierta región de un cierto minisatélite con un alto grado de variabilidad. En la huella génica del sujeto solo aparecen dos bandas individuales, una heredada de la madre y otra del padre.

En el caso de material genético que se pueda encontrar en un cuerpo carbonizado, del esqueleto de una momia egipcia, del cráneo de un Neardental, de las pocas células que quedan en la boquilla de un cigarrillo o en el bulbo de un pelo que contiene 0.0000000001 gramos de ADN. Para los genestistas, conseguir una huella génica que pudiera reconocer a un número de bases, era como buscar una aguja en un pajar. La solución a este problema llegó en 1983, con la amplificación enzimática del ADN o reacción en cadena de la polimersasa (PCR) . A partir de una molécula de ADN, la PCR es capaz de generar 100 mil millones de copias idénticas en una tarde. Ahora, con esta fotocopiadora biológica, los científicos se encuentran con miles de millones de agujas en el pajar. La reacción en  cadena de la polimersasa, esta ha reemplazado en gran parte, a la clásica y laboriosa clonación de ADN. En un plásmido –un pequeño anillo de ADN humano que se desee. Reprogramando bacterias y levaduras, los biotecnólogos los obligan a producir copias de dicho plásmido y de la secuencia buscada. La información de esta última se puede obtener utilizando las técnicas de hibridación de oligonucleótidos y de secuenciación. A comienzos de la era de los ochentas la mayor parte de información sobre los fragmentos de material hereditario procedía de la clonación (hace más de treinta años).

Aplicaciones desde luego no le faltan. En investigaciones forenses, la PCR es de gran ayuda para resolver homicidios mediante muestras de sangre degradada, para ahondar más en el origen de las enfermedades humanas en muestras biológicas de más de 50 años, ayuda a diagnosticar taras genéticas en embriones humanos, puede detectar el virus del SIDA en la sangre antes de que nuestro organismo haya fabricado anticuerpos para combatirlo y ya empezó a ser útil en la lucha contra ciertos cánceres.

La sangre es una fuente excelente de ADN, está presente en los glóbulos blancos o leucocitos, pero no en los glóbulos rojos o eritrocitos, pues estos últimos carecen de núcleo. Una mancha de sangre del tamaño de una moneda de un peso mexicano, corresponde a unos 50 microlitos que tiene suficiente ADN para realizar un análisis de VNTR.

El ADN de la cabeza de los espermatozoides es habitualmente la fuente más importante de ADN como prueba del delito en casos de ataque sexual. Cinco microlitros de semen contienen aproximadamente la misma cantidad de ADN que 50 de sangre. Para liberar el ADN de las cabezas de los espermatozoides se requieren métodos de extracción especiales. En consecuencia, las muestras de ataque sexual se puede extraer de forma diferencial: la primera extracción proporciona principalmente el ADN de células epiteliales de la víctima, mientras que la segunda extracción rinde principalmente ADN del semen.

La saliva contiene material celular. Se puede extraer ADN, para su análisis, a partir de marcas de mordisco, colillas de cigarrillo, escupitajos, sellos de correo pegados en el sobre o cierres engomados de sobre. El una gota de sudor contiene ADN suficiente para determinar la identidad de cualquier individuo.

El folículo capilar de la base del cabello humano contiene material celular rico en ADN. Para poderlo usar en análisis de ADN, el cabello debe haber sido arrancado, los cabellos que caen por rotura no contienen ADN. Cualquier tejido del cuerpo que no se haya degradado es una fuente potencial de ADN.

El hueso es una de las mejores fuentes de ADN a partir de restos humanos descompuestos. Incluso cuando la carne se ha descompuesto, a menudo se puede obtener ADN del hueso desmineralizado. Se ha usado ADN de hueso para identificar los huesos repatriados de soldados de los tiempos de la guerra de Vietnam, de los soldados muertos en la operación Tormenta del Desierto. y los restos de la familia rusa Romanov (El Zar, la Zarina, sus hijos), que fue ejecutada durante la revolución bolchevique.

Al igual que los huesos, los dientes pueden ser también una fuente excelente de ADN, mucho después de que el resto del cuerpo se haya descompuesto.

La orina no contiene por sí misma ADN, pero puede contener células epiteliales, que sí tienen ADN. Sin embargo, la mayoría de personas sanas no excretan células epiteliales en su orina.

 En Ayotzinapa. Gro, no se encontró nada, pelo, dientes, huesos, sangre, orina, sudor, lágrimas, moco, carne quemada, ropas, objetos ¡nada!; lo que lleva a pensar que todo fue dispuesto de tal forma que no se encontraran evidencias; pero, hay algo que considerar, los estudiantes secuestrados, desaparecidos y asesinados, nunca estuvieron en donde “dicen que estuvieron”. Los llevaron de inmediato a un Campo en donde fueron muertos y cremados. ¡Pruebas, pruebas! Desgarrándose las vestiduras gritan por ejemplo personajes como el Lic. Campa, que no cree que haya en México torturas, violaciones, secuestros, desapariciones, asesinatos, impunidad. ¡Solo ocurren en sitios aislados, contados con una mano y son eventos totalmente esporádicos! Extraordinario y excepcional país en donde vive el Lic. Campa, yo quiero vivir ahí también. Todo eso ocurre en otros países, ¡Aquí en México, no! ¡De rositas!, diría mi abuela ¡de rositas!

Todo este rollo, pensarán algunos, es para decir que en los “cuatro camiones o los cinco camiones” que según las investigaciones, transportaron a los normalistas, están llenos (o, ¿estaban?) llenos de evidencias, pelos, sangre, saliva, células dérmicas, etc.) que podían haber aportado pruebas suficientes, para saber si los transportaron o los mataron ahí mismo. Y ahí también hubieran encontrado rastros de todo tipo, de los captores/asesinos, que se podían comparar con las huellas y ADN que se tienen de cada uno de los elementos del ejército, marina o de los mismos delincuentes, que se supone debe existir en alguna parte de los archivos policiacos o de las fuerzas castrenses. ¿En donde están esas pruebas de los médicos forenses mexicanos? ¿Y qué fue lo que escribieron en sus reportes después de los estudios realizados? O, ¿ni siquiera hicieron los análisis de cada camión, asientos, piso, ventanas, pasamanos, escalerillas, de los autos en donde se suponen que iban los atacantes, los tapetes, alfombras, cajuelas, volantes, manijas, puertas; los calibres de los proyectiles de arma de fuego que se utilizaron, el piso, pavimento, cercas, paredes, setos, coladeras, colillas de cigarros, etc., y un largo etcétera.  No hubo huellas dactilares, ni de zapatos, tenis, de ropa, fibras naturales o sintéticas. Y como el nombre del conjunto inglés..” ni sangre, sudor o lágrimas”. Pero lo peor de todo es que nadie encontró ¡nada! Nada de nada, ahora sí como dice la conseja popular ¡ni un pelo!. Eso señores (quienes ordenaron, ejecutaron, hicieron la búsqueda y ocultaron las pruebas) se los dejo a su conciencia.

La determinación del DNA representa un medio excelente que permite a los científicos forenses utilizarla para la identificación de asesinos y violadores.

Las prueba forenses que se hacían con evidencias biológicas, encontradas generalmente en el sitio del crimen; semen, sangre y cabello, eran entre 90 y 95% correctas, lo que podría considerar algún elemento de duda, por ligero que fuera. Actualmente, el análisis del ADN no deja, lugar a duda, habiendo una identificación absoluta que antes no era posible lograr.

Los sistemas judiciales no siempre han aceptado las nuevas tecnologías científicas. No obstante, la tipificación del DNA, hasta el momento, no ha tropezado con mayores obstáculos.

En los EU, en la actualidad, existen tres compañías que trabajan con el sistema forense DNA: Cellmark, en Germantown, Maryland; Lifecodes Corporation de Nueva York, y Forensic Science Associates de Richmond, California. Sin embargo, se prevé que muy pronto existirán un mayor número de empresas similares.

Las agencias judiciales del gobierno de los EU, tales como el FBI, ya están adecuándose a la tipificación del DNA.

Como resultado de esta innovación surge ya, el banco de datos de DNA, el cual podrá usarse como ahora se utilizan los archivos de huellas digitales que guarda el FBI.

Son numerosos los casos de asesinato y de violación en los EU que han quedado definitivamente resueltos a través de la tipificación DNA; casos en los que no hubiera sido posible la identificación del criminal por ningún otro tipo de testimonio.

De acuerdo con lo dicho la técnica que emplean es un juego diferente de activadores para la identificación de los polimorfismos DNA. La mayoría de los activadores detectan secuencias repetidas de número variable específico en cadena (VNTR).

VNTR, siglas en inglés de Variable Number of Tandem Repeats, más conocidas como minisatélites, que son repeticiones de secuencias de entre 6-25 nucleótidos que incluyen miles de pares de bases, que se utilizan como marcadores moleculares. El número de repeticiones de estas secuencias, como bien indica su nombre, es variable.

La técnica de detección de los VNTR se puede realizar por hibridación del DNA o por técnicas de PCR.

El mecanismo de la técnica por hibridación es prácticamente igual a la técnica de RFLPs, siendo este la digestión de las muestras de DNA mediante enzimas de restricción, para posteriormente separar los fragmentos mediante electroforesis. Después se transfiere a una membrana (Southern blot) y se detectan los VNTR mediante sondas.

La base molecular para la identificación también es la misma que con los RFLPs: la secuencia de DNA es igual entre los diferentes individuos, lo que nos hace diferentes son las veces que estas secuencias se repiten.

La exactitud de la tipificación VNTR se logra a través de varios activadores, cada uno de los cuales reconoce un punto VNTR, para caracterizar una muestra DNA.

Una vez que se han establecido las frecuencias de los distintos patrones producidos por los activadores para los diferentes grupos étnicos, pueden usarse para calcular la probabilidad de que ocurra cualquier combinación de patrones en un individuo.

Se estima que existen alrededor de 5000 VNTR en distintos lugares del ADN humano. Tras regiones en el genoma poseen secuencias repetidas aún más pequeñas: son los microsatélites o secuencias cortas de repetición en tándem (STR – short tándem repeats). Están formadas por dos a cinco pares de bases repetidas un número variables de veces en cada individuo. La longitud de los VNTR y de los STR depende el número de veces que se repita la secuencia y es variable de persona a persona. Su tamaño es una característica  propia de cada individuo.

Los distintos métodos de DNA se pueden utilizar para los casos de pruebas de paternidad y para la identificación tanto de víctimas como de los que perpetran los crímenes.

Por rutina en los EU, en las fuerzas armadas como en los empleados federales, se les toman las huellas digitales en forma rutinaria, esto sirve de identificación pero la tipificación del ADN contiene información adicional, acerca del parentesco o la predisposición genética a una enfermedad, por lo que muchas personas no permiten fácilmente la determinación del ADN.

Saber que estás predispuesto a un cáncer, artritis reumatoide, alteración sistémica progresiva, al Sida, etc., pudiera pensarse que es malo, pero si antes de que aparezcan los síntomas puedes detectar y controlar estos eventos resultará más beneficioso a largo plazo. Pero bueno cada quien piensa diferente.

La tipificación del ADN en medio forense puede llegar a cambiar las tácticas de defensa en los juicios penales en donde la identidad es primordial. Una prueba que identifique, sin lugar a dudas, al sospechoso de violación acaba con los alegatos de inocencia.

¿Cuántos políticos han cometido violaciones físicas contra niños y adultos de ambos sexos, y ni siquiera son sometidos a juicio, porque las personas afectadas temen que los asesinen; pero imaginen que pudiéramos demostrar que son unos violadores o asesinos? Ya que solamente necesitaríamos un pelo, células epiteliales, saliva, sangre, esperma, piel desprendida para llegar a una identificación 100% exacta. ¿Cuántos estarían tras las rejas?

Pero lo que sabe es que los primeros que se oponen a este tipo de identificación son los políticos mexicanos. ¿Por qué será? ¡No lo sé!

Por supuesto, la tipificación del DNA puede exonerar a un sospechoso como incriminarlo. Se han reportado los casos en que los que el análisis de ADN demostraron que el presunto sospechoso no tuvo ninguna coincidencia con una muestra de sangre o semen, es importante reconocer, que este tipo de pruebas es la mejor defensa si hay acusación falsa.

Si entre nosotros los mexicanos (familia, comunidad, sociedad) criticamos algo malo, entonces somos mala onda, criticones, apátridas, levanta/falsos; si lo dicen extranjeros es blasfemia, mentira, opiniones personales nada objetivas, verdades a medias. ¡Ah! Pero si lo dice algún político mexicano, es verdad incontrovertible, absoluta, la pura neta, la sapiencia, la claridad, la probidad, la rectitud, la templanza, etc.; todo lo demás es falacia pura.    

¿Alguna vez podremos conocer los resultados del ADN encontrado en tantos casos de asesinato, violaciones, muertes misteriosas, secuestros que ocurren en este mi México? Y ¿compararlos contra asesinos, violadores, secuestradores y políticos que cometen estas atrocidades? Probablemente nunca, el 98% de la impunidad que ocurre en México hay que mantenerla ¿y quién tendría que cuidarla? Pues los propios presuntos culpables. La impunidad debe seguir con cifras altas, no podemos dejar que se pierda. ¡Adelante!

Como acotación final, podemos decir que la prueba de reacción en cadena de la polimerasa (PCR) es un proceso de detección de un agente infeccioso por amplificación genética que se desarrolla de manera habitual en tres etapas. La primera consiste en la extracción y purificación de los ácidos nucleicos del microorganismo de la muestra biológica, seguido de la amplificación de un segmento seleccionado del genoma del microorganismo mediante reacción en cadena de la polimerasa, es decir, la PCR propiamente dicha. Finalmente, en la tercera etapa se lleva a cabo la detección de los fragmentos amplificados en la PCR (amplicones) por electroforesis en gel de agarosa y tinción con bromuro de etidio, o mediante hibridación con sondas específicas. En general todo este proceso suele durar aproximadamente 24 h.

En el primer ciclo, de una molécula se obtienen dos. Al repetir este proceso en forma progresiva, la cantidad de copias del fragmento de ADN aumenta en forma geométrica hasta 10 a la 17, copias por termino medio.

Al poder multiplicar millones de veces una mínima porción de material genético, los científicos son capaces de detectar de forma casi inmediata la existencia de un virus determinado, bacteria, hongo o alteración cromosómica en el organismo muchísimo antes de que aparezcan los primeros síntomas.

“La PCR se actualizará, sin lugar a dudas, la medicina en los próximos años, permitiendo el diagnóstico precoz de padecimientos varios, al hacer posible la identificación de una sola célula infectada entre cien mil sanas”. Se decía en 1991.

Desafortunadamente estas expectativas que se manejaban hace poco más de veinte años, han cambiado.

Hoy en día, la reacción en cadena de la polimerasa (PCR) se utiliza normalmente en la rutina asistencial de la mayoría de los laboratorios, pero su empleo se ha limitado, con pocas excepciones, al campo de la virología y en especial a un reducido grupo de virus con gran interés económico para las empresas de diagnóstico microbiológico, como por ejemplo virus de la inmunodeficiencia humana (VIH), de la hepatitis C (VHC)  de la hepatitis B (VHB) o citomegalovirus.

Por diversas razones, la PCR convencional se ha implementado poco en el diagnóstico de otras muchas enfermedades infecciosas a pesar de aportar indudables ventajas. Lo que significa que no interesa a los Laboratorios de Investigación invertir bastante dinero, para que una simple prueba nos diga que “podría sufrir alguna enfermedad infecciosa en algunos meses, así es mejor que se prepare o se atienda”. Ya no tendría que comprar el antibiótico, o antiviral o retroviral o un cuerpo monoclonal para que se cure (que cuestan miles de pesos) . Pues “realizando o practicando algunas medidas o tomando ciertos medicamentos genéricos, se puede prevenir el problema infeccioso”. Imagínense la catástrofe.

Bibliografía:

Alec J. Jeffreys. SCIENCE 1º agosto/1986, página 521.

Minisatellite repeat coding as a digital approach to DNA typing. Alec J. Jeffreys et al. Nature, Vol 354. 21 nov/1991

The polimerasa chain reaction. Barry I. Eisenstein. New Englend Journal Medicine. No 322. Jan/1990

Reacción en cadena de la polimerasa (PCR) a tiempo real. Capítulo 12. Puesta al día en métodos microbiológicos para el diagnóstico clínico. Josep Costa
Servicio de Microbiología. Hospital Clínic i Provincial. Barcelona. España. ecaths1.s3.amazonaws.com/…/306426888.PCR%20TIEMPO%20REAL

You might also like More from author

53 Comments

  1. 0mniartist says

    I like the helpful information you provide in your articles.
    I will bookmark your blog and check again here regularly.
    I am quite sure I will learn a lot of new stuff right
    here! Best of luck for the next! asmr 0mniartist

  2. asmr https://0mniartist.tumblr.com says

    Its like you read my mind! You seem to understand a lot about this, such as you wrote the e-book in it or something.

    I feel that you simply can do with a few percent to force
    the message home a little bit, but instead of that,
    this is excellent blog. A great read. I will definitely be back.
    asmr 0mniartist

  3. cigo says

    In writing, three or more sentences are included by many paragraphs, though over ten years. How many paragraphs exactly are a lot of, and also are enough? There ought to be twelve and six at an five-page specific article, or even different between six and four paragraphs at an newspaper. https://printcasting.com/help-in-writing-a-thesis-statement/

  4. click here for more info says

    My brother recommended I might like this web site. He was entirely right. This post truly made my day. You can not imagine simply how much time I had spent for this information! Thanks!

  5. chăm sóc thu cưng says

    Wonderful post however , I was wondering if you could write a litte more on this subject? I’d be very grateful if you could elaborate a little bit further. Thanks!

  6. web hosting says

    This post provides clear idea in support of the new viewers of blogging, that truly
    how to do running a blog.

  7. web hosting says

    I got this web site from my buddy who told me regarding this web page and at
    the moment this time I am browsing this web page and reading very informative content at this
    time.

  8. tinyurl.com says

    Hey are using WordPress for your blog platform?
    I’m new to the blog world but I’m trying to get started and set up my own. Do you require any html coding knowledge to make
    your own blog? Any help would be greatly appreciated!

  9. j.mp says

    Thank you for the auspicious writeup. It in fact was a amusement account it.

    Look advanced to more added agreeable from you! By the way, how could we communicate?

  10. j.mp says

    Hello are using WordPress for your blog platform? I’m new to the blog world but I’m trying to get started and create my own. Do
    you need any coding expertise to make your own blog? Any help would be really appreciated!
    games ps4 185413490784 games ps4

  11. gamefly says

    Hi, i feel that i noticed you visited my website thus i came
    to return the prefer?.I’m attempting to in finding issues to enhance my site!I guess its good enough to use some of your concepts!!
    games ps4 185413490784 games ps4

  12. tinyurl.com says

    If you wish for to obtain a good deal from this paragraph then you have
    to apply such strategies to your won weblog.

  13. WWW.XMC.pl says

    Please email me with some hints about how you made your blog look this cool, I would be appreciative!

  14. Kreatywna says

    Spot on with this write-up, I truly assume this website needs much more consideration. I’ll probably be again to read rather more, thanks for that info.

  15. Kreatywna says

    Wonderful work! This is the type of information that should be shared around the net. Shame on the search engines for not positioning this post higher! Come on over and visit my website . Thanks =)

  16. Kreatywna says

    We are a gaggle of volunteers and opening a brand new scheme in our community. Your site offered us with helpful info to work on. You’ve performed an impressive task and our entire neighborhood will probably be thankful to you.

  17. Kreatywna says

    You completed various nice points there. I did a search on the theme and found the majority of people will have the same opinion with your blog.

  18. WikiSaber says

    you’re really a good webmaster. The website loading speed is amazing. It seems that you’re doing any unique trick. Furthermore, The contents are masterpiece. you have done a magnificent job on this topic!

  19. WikiSaber says

    Heya! I’m at work surfing around your blog from my new iphone! Just wanted to say I love reading your blog and look forward to all your posts! Carry on the fantastic work!

  20. Apple says

    Wow, wonderful weblog format! How lengthy have you been blogging for? you make blogging glance easy. The total look of your website is excellent, let alone the content!

  21. Apple says

    I’m not that much of a internet reader to be honest but your blogs really nice, keep it up! I’ll go ahead and bookmark your website to come back in the future. Many thanks

  22. Apple says

    very good put up, i actually love this web site, keep on it

  23. Apple says

    Pretty nice post. I just stumbled upon your weblog and wanted to say that I have truly loved browsing your blog posts. In any case I’ll be subscribing to your rss feed and I am hoping you write again soon!

  24. Apple says

    Aw, this was a really nice post. In concept I wish to put in writing like this additionally – taking time and actual effort to make a very good article… but what can I say… I procrastinate alot and not at all appear to get something done.

  25. Apple says

    Hello there, just turned into alert to your blog thru Google, and found that it is really informative. I’m going to be careful for brussels. I will appreciate for those who continue this in future. Lots of folks might be benefited from your writing. Cheers!

  26. Apple says

    Hello just wanted to give you a quick heads up and let you know a few of the pictures aren’t loading correctly. I’m not sure why but I think its a linking issue. I’ve tried it in two different web browsers and both show the same outcome.

  27. tinyurl.com says

    Thanks to my father who told me about this blog, this webpage is in fact amazing.

  28. Apple says

    I precisely had to thank you so much yet again. I’m not certain the things I might have achieved in the absence of the smart ideas discussed by you concerning this field. It absolutely was a hard situation in my opinion, nevertheless looking at a skilled strategy you resolved the issue forced me to cry for happiness. Now i’m thankful for the advice and then believe you are aware of an amazing job you’re accomplishing teaching men and women all through your webpage. Most likely you have never encountered all of us.

  29. Apple says

    Sweet blog! I found it while searching on Yahoo News. Do you have any suggestions on how to get listed in Yahoo News? I’ve been trying for a while but I never seem to get there! Thank you

  30. tinyurl.com says

    Good article! We are linking to this great article on our website.

    Keep up the great writing.

  31. cheap flights says

    If you desire to obtain much from this piece
    of writing then you have to apply such methods to your won weblog.

  32. tinyurl.com says

    This information is worth everyone’s attention. Where can I find out more?

  33. cheap flights says

    I just like the valuable info you provide on your articles.
    I’ll bookmark your blog and take a look at once
    more right here regularly. I am slightly sure I will be told a lot of new stuff proper
    right here! Good luck for the next!

  34. creditos al instante says

    After examine a few of the weblog posts in your web site now, and I actually like your method of blogging. I bookmarked it to my bookmark web site listing and might be checking back soon. Pls check out my website online as well and let me know what you think.

  35. Apple says

    The subsequent time I learn a blog, I hope that it doesnt disappoint me as much as this one. I imply, I do know it was my choice to learn, but I actually thought youd have something fascinating to say. All I hear is a bunch of whining about one thing that you could repair for those who werent too busy searching for attention.

  36. Apple says

    You made some nice points there. I looked on the internet for the subject matter and found most guys will consent with your site.

  37. prestamos rapidos 2000 euros says

    Generally I do not read article on blogs, but I would like to say that this write-up very forced me to try and do it! Your writing style has been surprised me. Thanks, very nice article.

  38. creditos rapidos says

    Normally I don’t read post on blogs, but I wish to say that this write-up very forced me to try and do so! Your writing style has been amazed me. Thanks, very nice article.

  39. what is seo says

    Hey! Would you mind if I share your blog with my myspace group? There’s a lot of folks that I think would really enjoy your content. Please let me know. Many thanks

  40. my latest blog post on golf says

    Hi there would you mind sharing which blog platform you’re using? I’m planning to start my own blog in the near future but I’m having a hard time making a decision between BlogEngine/Wordpress/B2evolution and Drupal. The reason I ask is because your design and style seems different then most blogs and I’m looking for something completely unique. P.S Apologies for getting off-topic but I had to ask!

  41. official site créditos rápidos says

    I appreciate, cause I found exactly what I was looking for. You’ve ended my 4 day long hunt! God Bless you man. Have a great day. Bye

Leave A Reply

Your email address will not be published.